Desmin Myopathy, miopatia szkieletowa z kardiomiopatią spowodowaną mutacjami w genie Desmina cd

Pacjenci 5 i 6 nie mieli rodzinnej historii miopatii i nie byli spokrewnieni. U pozostałych 12 pacjentów z miopatią związaną z miofibrylem lub desginem, którzy nie mieli mutacji w genie desminy, miopatia była klinicznie i histologicznie podobna do tej u pacjentów z miopatią desminy, z tym że choroba wystąpiła w późniejszym okresie życia (średni wiek, 39 lat) i nie było kardiomiopatii.
Analiza histologiczna, mikroskopia elektronowa i immunocytochemia
Biopsje mięśni wykonano u wszystkich pacjentów. Próbki poddano obróbce histochemicznej i immunocytochemicznej w sposób opisany wcześniej.13 Szeregowe sekcje o grubości 5 .m barwiono zmodyfikowanym trichromem Gomori lub przeciwciałami przeciwko desminie w rozcieńczeniu 1: 100 (klon D33, Dako), przeciwciałami przeciwko dystrofinie w rozcieńczenie 1:50 (klony Dy4 / 6D3 i Dy8 / 6C5, Novocastra Laboratories), przeciwciała przeciwko wimentynie w rozcieńczeniu 1: 200 (klon V9, Zymed) i przeciwciała przeciwko .-spektrynie w rozcieńczeniu 1: 100 ( klonować RB2 / 3D5, Novocastra Laboratories). W przypadku przeciwciał drugorzędowych stosowano kozie anty-mysie IgG sprzężone z fluoresceiną lub sprzężone z rhodaminą kozie antymonu IgG. Próbki mięśni zostały również poddane obróbce pod mikroskopem elektronowym, jak opisano wcześniej.13
Analiza mutacji
Całkowity RNA wyizolowano z próbek biopsji mięśni za pomocą zestawu (zestaw RNeasy, Qiagen). Odwrotną transkrypcję przeprowadzono przy użyciu 3 .g całkowitego RNA zgodnie z instrukcjami producenta (zestaw odwrotnej transkryptazy SuperScript II, GIBCO BRL), a następnie reakcji łańcuchowej polimerazy (PCR) ze starterami specyficznymi dla desminy dF (5 CCGTCACCATGAGCCAGG3 ) i dR. (5 AGAGGGTCTCTCGTCTTTAG3 ) 11,14 Amplifikację przeprowadzono w całkowitej objętości 20 .l zawierającej .l jednoniciowego komplementarnego DNA (cDNA), 0,5 .M każdego startera, 125 .M każdego trifosforanu deoksynukleotydu, 1,5 mM magnezu. chlorek, 10 mM TRIS kwas solny (pH 8,3), 50 mM chlorek potasu i 0,6 jednostki polimerazy rTth (Perkin-Elmer Cetus). Uzyskane fragmenty DNA oczyszczono (zestaw do ekstrakcji z żelu Qiaex II, Qiagen) i wklonowano do wektora do klonowania TA (Invitrogen). Obie nici zsekwencjonowano w co najmniej dziewięciu klonach.
Próbki krwi pobierano od pacjentów, ich krewnych i osób zdrowych i przechowywano w probówkach traktowanych heparyną. Genomowy DNA wyekstrahowany z tych próbek krwi zastosowano jako matrycę do testu PCR, ze starterami specyficznymi dla sekwencji desminy konstruowanych dla oddzielnych eksonów. Amplifikację przeprowadzono stosując procedurę zaprojektowaną dla każdego eksonu. Powstałe fragmenty DNA subklonowano (TA Cloning Kit, Invitrogen) i obie nici zsekwencjonowano w co najmniej sześciu klonach. Sekwencjonowanie klonowanego DNA i cDNA przeprowadzono zgodnie z instrukcjami producenta (DyePrimer Sequencing, Perkin-Elmer Cetus) na automatycznym sekwenatorze DNA (model 373A, Applied Biosystems).
Te same amplikony zostały również strawione endonukleazami restrykcyjnymi (BsaHI, Bsp1286I, Ncol, Sbf I, BsaWI i RsaI, New England Biolabs i TaiI, MBI Fermentas) zgodnie z instrukcjami producenta i poddane elektroforezie na 4% żelu agarozowym z niska temperatura topnienia (NuSieve GTG, FMC BioProducts)
[przypisy: wstęga przyśrodkowa, zespół hutchinsona gilforda, falvit forum ]
[więcej w: balneolog, balneoterapia, bataty wartości odżywcze ]